LipoKnoxa™ Human PRKAA2 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX555-1	GAGCATGTACCTACGTTATTT	CDS	Inquiry
V0126XX555-2	AGATAGCCGATTTCGGATTAT	CDS	Inquiry
V0126XX555-3	GGTGTAGGTAAATCTAGTTTA	3' UTR	Inquiry
V0126XX555-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PRKAA2 shRNA Lentiviral Particle (Silencing) targets the alpha-2 subunit of AMPK, the cell’s primary energy sensor. By offering both U6 and miR30-based shRNA systems, this tool assists in uncovering energy-sensing pathways in muscle and liver. To ensure the highest level of biosafety, all products undergo total QC verification for functional titer and pathogens.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PRKAA2

Full Name: Protein kinase AMP-activated catalytic subunit alpha 2

Gene Symbol: AMPK; AMPK2; PRKAA; AMPKa2

Gene ID: 5563

RefSeq ID-1: NP_006243.2

RefSeq ID-2: NM_006252.3

Summary: PRKAA2 encodes the alpha-2 catalytic subunit of AMP-activated protein kinase (AMPK), the cell's primary energy sensor. Activated by metabolic stress and high AMP levels, this subunit phosphorylates key enzymes like ACC and HMGCR to inhibit the synthesis of fatty acids and cholesterol. It is essential for maintaining whole-body insulin sensitivity and myocardial energy balance during ischemic events.

LipoKnoxa™ Human PRKAA2 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products