LipoKnoxa™ Human FGF21 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX528-1	TCCAGTCCTCTCCTGCAATTC	CDS	Inquiry
V0126XX528-2	GCTTCTTGAGGACGGATACAA	CDS	Inquiry
V0126XX528-3	GCCGGGAGTTATTCAAATCTT	CDS	Inquiry
V0126XX528-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human FGF21 shRNA Lentiviral Particle (Silencing) focuses on the persistent knockdown of FGF21, a hormone regulating glucose and lipid metabolism. By offering both high-potency U6 systems and physiologically refined miR30-based shRNA, this tool helps researchers investigate metabolic adaptation. Rigorous quality control, including functional titering and microbial contaminants screening, is conducted on every batch.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: FGF21

Full Name: Fibroblast growth factor 21

Gene ID: 26291

RefSeq ID-1: NP_061986.1

RefSeq ID-2: NM_019113.4

Summary: FGF21 is a secreted endocrine factor that acts as a potent metabolic rheostat. A member of the fibroblast growth factor family, it specializes in regulating glucose uptake in adipose tissue and enhancing fat oxidation. FGF21 is often induced during nutritional stress or fasting to improve insulin sensitivity and energy expenditure, making it a highly promising target for anti-obesity therapeutics.

LipoKnoxa™ Human FGF21 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products