Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human FGF21 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX528
Species: Human
Target Gene: FGF21
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human FGF21 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX528-1 TCCAGTCCTCTCCTGCAATTC CDS Inquiry
V0126XX528-2 GCTTCTTGAGGACGGATACAA CDS Inquiry
V0126XX528-3 GCCGGGAGTTATTCAAATCTT CDS Inquiry
V0126XX528-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human FGF21 shRNA Lentiviral Particle (Silencing) focuses on the persistent knockdown of FGF21, a hormone regulating glucose and lipid metabolism. By offering both high-potency U6 systems and physiologically refined miR30-based shRNA, this tool helps researchers investigate metabolic adaptation. Rigorous quality control, including functional titering and microbial contaminants screening, is conducted on every batch.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: FGF21
Full Name: Fibroblast growth factor 21
Gene ID: 26291
RefSeq ID-1: NP_061986.1
RefSeq ID-2: NM_019113.4
Summary: FGF21 is a secreted endocrine factor that acts as a potent metabolic rheostat. A member of the fibroblast growth factor family, it specializes in regulating glucose uptake in adipose tissue and enhancing fat oxidation. FGF21 is often induced during nutritional stress or fasting to improve insulin sensitivity and energy expenditure, making it a highly promising target for anti-obesity therapeutics.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.