LipoKnoxa™ Human CCKAR shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX575-1	ACCACCAGCAGCGGCAAATAT	CDS	Inquiry
V0126XX575-2	TAACAACCAGACCGCGAATAT	CDS	Inquiry
V0126XX575-3	CTCTTGTACTCCTTGATATTC	CDS	Inquiry
V0126XX575-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CCKAR shRNA Lentiviral Particle (Silencing) is specifically engineered to achieve stable and efficient suppression of the cholecystokinin A Receptor, a pivotal mediator of satiety and gallbladder function. Utilizing both deep-silencing U6-driven shRNA and physiologically optimized miR30 architectures, this product enables researchers to model appetite regulation defects in gut or brain-derived cell lines. Every batch is verified through a total quality control suite—including high-sensitivity functional titer assays, sterility checks, and mycoplasma detection—to ensure that your experimental results are scientifically sound and highly reproducible.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CCKAR

Full Name: Cholecystokinin A receptor

Gene Symbol: CCK-A; CCK1R; CCKRA; CCK-1R; CCK1-R

Gene ID: 886

RefSeq ID-1: NP_000721.1

RefSeq ID-2: NM_000730.3

Summary: CCKAR encodes a G-protein-coupled receptor for cholecystokinin (CCK) peptides, mediating satiety signals in the central and peripheral nervous systems. It also regulates pancreatic enzyme secretion and smooth muscle contraction in the digestive tract. Genetic variants affecting CCKAR function can influence appetite, feeding behavior, and obesity susceptibility.

LipoKnoxa™ Human CCKAR shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products