LipoKnoxa™ Human TFAP2B shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX592-1	TTGGACCAGTCTGTCATTAAA	CDS	Inquiry
V0126XX592-2	GCGTACAACGGAGCAACAATA	3' UTR	Inquiry
V0126XX592-3	CAAAGCCGTCTCTGAGTATTT	CDS	Inquiry
V0126XX592-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human TFAP2B shRNA Lentiviral Particle (Silencing) targets a transcription factor strongly associated with adipose distribution and type 2 diabetes risk. Our customizable lentiviral platform supports the choice between U6 and miR30-based shRNA architectures to investigate the genetic control of lipid storage and adipocytokine secretion. To ensure experimental reliability, all particles undergo rigorous quality control screening, ensuring high functional titers and excellent biosafety for a reliable long-term in vitro study.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: TFAP2B

Full Name: Transcription factor AP-2 beta

Gene Symbol: PDA2; AP-2B; AP2-B; AP-2beta

Gene ID: 7021

RefSeq ID-1: NP_003212.2

RefSeq ID-2: NM_003221.4

Summary: As a member of the AP-2 transcription factor family, TFAP2B serves as a developmental architect, stimulating cell growth while suppressing the premature maturation of specific cell lineages. While mutations in this gene are known to cause Char syndrome, affecting neural crest derivatives, TFAP2B is also a significant genetic locus in obesity research, where it helps dictate the differentiation program of adipose tissue.

LipoKnoxa™ Human TFAP2B shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products