LipoKnoxa™ Human PPARG shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX426

Species: Human

Target Gene: PPARG

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human PPARG shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX426-1	GACAGCGACTTGGCAATATTT	CDS	Inquiry
V0126XX426-2	CTGGCCTCCTTGATGAATAAA	CDS	Inquiry
V0126XX426-3	ATGGAGTCCACGAGATCATTT	CDS	Inquiry
V0126XX426-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PPARG shRNA Lentiviral Particle (Silencing) provides a specialized solution for silencing the master regulator of adipogenesis, PPAR-gamma. Developed using optimized U6 and miR30-based shRNA systems, this tool enables researchers to block adipocyte differentiation and study lipid storage mechanisms with high specificity. Every batch is verified through a comprehensive QC suite—including functional titer, sequence accuracy, and sterility testing—ensuring that your adipocyte research is both safe and reproducible.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PPARG

Full Name: Peroxisome proliferator activated receptor gamma

Gene Symbol: GLM1; CIMT1; FPLD3; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma

Gene ID: 5468

RefSeq ID-1: NP_005028.4

RefSeq ID-2: NM_005037.5

Summary: The PPARG gene is a critical regulator coding for peroxisome proliferator-activated receptor gamma, a central member of the nuclear receptor family. Its mechanism of action requires heterodimerization with retinoid X receptors (RXR), enabling it to function as a master transcription factor controlling pathways essential for adipogenesis (fat cell creation). As a molecular switch for lipid storage and glucose handling, dysregulation of PPAR gamma is heavily implicated in the pathogenesis of metabolic syndrome, including type 2 diabetes, severe obesity, atherosclerosis, and several malignancies. Multiple isoforms exist due to alternative splicing.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out