LipoKnoxa™ Human MYT1L shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX508-1	GCAGCAAGACAGTAGAAATAT	CDS	Inquiry
V0126XX508-2	CGTGACTACTTTGACGGAAAT	CDS	Inquiry
V0126XX508-3	CGAAAGCCATTTGCCGTGAAA	CDS	Inquiry
V0126XX508-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human MYT1L shRNA Lentiviral Particle (Silencing) targets a transcription factor involved in neuronal differentiation and obesity-related developmental phenotypes. Silencing MYT1L through our dual-strategy shRNA platform (U6 and miR30) helps researchers model neurodevelopmental energy regulation. Every viral preparation is backed by exhaustive QC validation, including high-precision titering and sterility testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: MYT1L

Full Name: Myelin transcription factor 1 like

Gene Symbol: NZF1; MRD39; myT1-L; ZC2H2C2; ZC2HC4B

Gene ID: 23040

RefSeq ID-1: NP_001289981.1

RefSeq ID-2: NM_001303052.2

Summary: MYT1L encodes a neuronal-specific zinc finger transcription factor involved in central nervous system development. Together with other transcription factors, MYT1L can reprogram fibroblasts into functional neurons capable of generating action potentials. Mutations in this gene have been linked to autosomal dominant cognitive disabilities and autism spectrum disorder. Multiple transcript variants exist due to alternative splicing.

LipoKnoxa™ Human MYT1L shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products