LipoKnoxa™ Human BBS10 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX466-1	GGAATCAGTAATGGGTAAATA	CDS	Inquiry
V0126XX466-2	CAACCAGATTTAGTTAGTTAT	CDS	Inquiry
V0126XX466-3	AGCTGTAAGTTACCGAATATG	CDS	Inquiry
V0126XX466-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human BBS10 shRNA Lentiviral Particle (Silencing) targets a chaperonin-like protein essential for the assembly of the BBSome complex. By utilizing our advanced RNAi platform with a choice of U6 or miR30-based systems, researchers can evaluate the impact of protein trafficking defects on metabolic homeostasis. Every viral preparation is backed by exhaustive QC validation, including high-precision titering, sterility, and mycoplasma testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: BBS10

Full Name: Bardet-Biedl syndrome 10

Gene Symbol: C12orf58

Gene ID: 79738

RefSeq ID-1: NP_078961.3

RefSeq ID-2: NM_024685.3

Summary: BBS10 is another member of the BBS gene family, associated with Bardet-Biedl syndrome type 10, which presents with progressive retinal degeneration, obesity, polydactyly, renal anomalies, and cognitive disability. Unlike most BBS proteins, BBS10 likely functions as a molecular chaperone, with distant homology to type II chaperonins, influencing the folding and stability of ciliary or basal body proteins. Disruption of BBS10 expression impairs ciliogenesis in preadipocytes.

LipoKnoxa™ Human BBS10 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products