LipoKnoxa™ Human LIPE shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX467-1	GAGCTCAGCAGCCTGATAAAG	CDS	Inquiry
V0126XX467-2	GCTGTCAGCTGAGACACTTAG	CDS	Inquiry
V0126XX467-3	TGCATAAGGGATGCTTCTATG	CDS	Inquiry
V0126XX467-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human LIPE shRNA Lentiviral Particle (Silencing) facilitates the stable knockdown of LIPE, the key enzyme in fatty acid mobilization. Our lentiviral particles are engineered with both U6 and miR30-based shRNA frameworks to study the regulation of lipolysis in adipocytes. Each preparation is verified via total QC validation—including functional titer, sequence identity, and mycoplasma detection—to ensure consistent performance.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: LIPE

Full Name: Lipase E, hormone sensitive type

Gene Symbol: HSL; LHS; REH; AOMS4; FPLD6

Gene ID: 3991

RefSeq ID-1: NP_001403032.1

RefSeq ID-2: NM_001416103.1

Summary: LIPE encodes hormone-sensitive lipase with long and short isoforms generated through alternative translational start sites. The long isoform is expressed in steroidogenic tissues, such as the testis, where it hydrolyzes cholesteryl esters for steroid hormone synthesis. The short isoform, expressed in adipose tissue, mobilizes stored triglycerides by converting them into free fatty acids, thereby playing a key role in lipid metabolism.

LipoKnoxa™ Human LIPE shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products