LipoKnoxa™ Human IRS2 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX524-1	CATGTCAGAGAGTATCATTAA	3' UTR	Inquiry
V0126XX524-2	GTGAAGATCTGTCTGGCTTTA	CDS	Inquiry
V0126XX524-3	ACCATCGTGAAAGAGTGAAGA	CDS	Inquiry
V0126XX524-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human IRS2 shRNA Lentiviral Particle (Silencing) targets IRS2, essential for leptin and insulin signaling in the brain. Engineered via our dual-strategy platform (U6 and miR30 systems), this tool allows for stable modeling of central insulin resistance. Each viral preparation is backed by exhaustive QC validation, including functional titer, sterility, and mycoplasma testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: IRS2

Full Name: Insulin receptor substrate 2

Gene Symbol: IRS-2

Gene ID: 8660

RefSeq ID-1: NP_003740.2

RefSeq ID-2: NM_003749.2

Summary: IRS2 serves as a vital molecular bridge in the insulin signaling cascade. Acting as an adaptor protein, it links activated receptor tyrosine kinases (like the insulin receptor or IGF-1 receptor) to downstream intracellular effectors. It is primarily regulated through phosphorylation. Dysfunction in the IRS2 pathway is a central mechanism in the development of insulin resistance, as it prevents the cell from correctly interpreting metabolic signals from the bloodstream.

LipoKnoxa™ Human IRS2 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products