Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human HSD11B1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX458
Species: Human
Target Gene: HSD11B1
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human HSD11B1 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX458-1 CCTCCATCAGAAAGGAATATT CDS Inquiry
V0126XX458-2 GAAGGAGTTCCTCTAACATTT 3' UTR Inquiry
V0126XX458-3 ATAGGTATAATTACCAGATAG 3' UTR Inquiry
V0126XX458-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human HSD11B1 shRNA Lentiviral Particle (Silencing) focuses on the persistent knockdown of HSD11B1, an enzyme that regenerates active cortisol within adipose and liver tissues. By utilizing optimized U6 and miR30-based shRNA delivery, this tool assists in uncovering the pathways of local glucocorticoid excess in metabolic syndrome. Every batch undergoes rigorous quality control, including high-precision functional titering and sterility testing, to ensure optimal reliability and data safety.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: HSD11B1
Full Name: Hydroxysteroid 11-beta dehydrogenase 1
Gene Symbol: HDL; 11-DH; HSD11; HSD11B; HSD11L; CORTRD2; SDR26C1; 11-beta-HSD1
Gene ID: 3290
RefSeq ID-1: NP_001193670.1
RefSeq ID-2: NM_001206741.2
Summary: This gene encodes a microsomal enzyme that catalyzes the interconversion of cortisol and cortisone. Overactivity can lead to excess cortisol, contributing to central obesity. Variants in HSD11B1 have been linked to obesity and insulin resistance in children. Mutations in HSD11B1 and H6PD cause cortisone reductase deficiency. Alternate splicing produces multiple transcript variants encoding the same protein.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.