LipoKnoxa™ Human GATA3 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX609-1	CCCAAGAACAGCTCGTTTAAC	CDS	Inquiry
V0126XX609-2	GCCAAGAAGTTTAAGGAATAT	3' UTR	Inquiry
V0126XX609-3	AGCCTAAACGCGATGGATATA	3' UTR	Inquiry
V0126XX609-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human GATA3 shRNA Lentiviral Particle (Silencing) targets a transcription factor that inhibits adipocyte differentiation to maintain the pre-adipocyte state. Engineered via our dual-strategy platform (U6 and miR30 systems), this tool enables researchers to investigate fat mass expansion and adipogenesis. Every preparation is verified via thorough QC validation—including functional titer, sequence accuracy, and sterility—ensuring excellent biosafety for reliable ex vivo applications.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: GATA3

Full Name: GATA binding protein 3

Gene Symbol: HDR; HDRS

Gene ID: 2625

RefSeq ID-1: NP_001002295.1

RefSeq ID-2: NM_001002295.2

Summary: GATA3 is a zinc-finger transcription factor that serves as a master regulator of T-cell identity and endothelial cell health. While primarily known for its role in the immune system, its influence on the vascular endothelium is critical for maintaining the healthy blood flow and nutrient exchange required for balanced systemic metabolism.

LipoKnoxa™ Human GATA3 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products