Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human ALMS1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX455
Species: Human
Target Gene: ALMS1
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human ALMS1 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX455-1 TTGTGAGTCTGGTTGAATAAA 3' UTR Inquiry
V0126XX455-2 GGCATTGCTAGGTAGTCAAAT CDS Inquiry
V0126XX455-3 GTATCTCAGCACCCGCTTATA CDS Inquiry
V0126XX455-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human ALMS1 shRNA Lentiviral Particle (Silencing) targets the gene responsible for Alström syndrome, providing a powerful model for researching ciliary dysfunction and early-onset obesity. Our system provides two distinct expression strategies—U6 and miR30-based shRNA—to accommodate diverse experimental requirements for silencing efficiency. Backed by exhaustive QC documentation, including functional titer and sequence integrity, this lentiviral tool ensures stable and reliable knockdown for long-term in vitro study.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ALMS1
Full Name: ALMS1 centrosome and basal body associated protein
Gene Symbol: ALSS
Gene ID: 7840
RefSeq ID-1: NP_001365383.1
RefSeq ID-2: NM_001378454.1
Summary: This gene encodes a protein with a large tandem-repeat domain and additional low-complexity regions, which is involved in microtubule organization and the formation and maintenance of cilia. Mutations in ALMS1 cause Alström syndrome. A pseudogene is located nearby on chromosome 2. Alternative splice variants exist, though their full-length sequences are not fully characterized.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.