LipoKnoxa™ Human SLC27A4 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX578-1	AGAGAGCAGGGAGCTTATAAA	3' UTR	Inquiry
V0126XX578-2	GTGGTGCACAGCAGGTATTAC	CDS	Inquiry
V0126XX578-3	CCTTGTCTTTGGCAGCGAAAT	CDS	Inquiry
V0126XX578-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human SLC27A4 shRNA Lentiviral Particle (Silencing) facilitates the robust silencing of the FATP4 fatty acid transporter, which is critical for dietary lipid uptake and epidermal barrier function. Our lentiviral particles are developed using both U6 and miR30-based shRNA frameworks, allowing for either maximal or regulated knockdown in cell lines. This product is indispensable for researching the control of lipid flux in obesity. To guarantee experimental success, every preparation is validated through total quality control, including functional titer, sterility, and sequence verification.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: SLC27A4

Full Name: Solute carrier family 27 member 4

Gene Symbol: IPS; FATP4; ACSVL4

Gene ID: 10999

RefSeq ID-1: NP_005085.2

RefSeq ID-2: NM_005094.3

Summary: SLC27A4 encodes a fatty acid transporter highly expressed in enterocytes, facilitating the uptake of long-chain fatty acids. By regulating dietary lipid absorption and systemic lipid levels, SLC27A4 affects energy storage and may influence obesity risk. Mutations are associated with metabolic and developmental disorders.

LipoKnoxa™ Human SLC27A4 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products