LipoKnoxa™ Human PRKAA1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX570-1	GTTGCCTACCATCTCATAATA	CDS	Inquiry
V0126XX570-2	GAAGGTTGTAAACCCATATTA	CDS	Inquiry
V0126XX570-3	GCACAGACAATTGCAGTAAAT	3' UTR	Inquiry
V0126XX570-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PRKAA1 shRNA Lentiviral Particle (Silencing) targets the alpha-1 subunit of AMPK, the fundamental energy sensor. By utilizing high-potency U6-driven shRNA or physiologically refined miR30 architectures, researchers can study global metabolic homeostasis. Every viral preparation is subjected to total QC verification—covering functional activity, sequence integrity, and sterility—to ensure high-fidelity results.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PRKAA1

Full Name: Protein kinase AMP-activated catalytic subunit alpha 1

Gene Symbol: AMPK; AMPKa1; AMPK alpha 1

Gene ID: 5562

RefSeq ID-1: NP_006242.5

RefSeq ID-2: NM_006251.5

Summary: PRKAA1 encodes the alpha-1 catalytic subunit of the AMPK heterotrimer. Acting as a ubiquitous energy sensor, it is triggered by an increase in the cellular AMP/ATP ratio. By switching off ATP-consuming synthetic pathways and activating ATP-producing catabolic pathways, PRKAA1 protects cells from energy exhaustion during metabolic stress.

LipoKnoxa™ Human PRKAA1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products