LipoKnoxa™ Human MAPK14 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX440

Species: Human

Target Gene: MAPK14

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human MAPK14 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX440-1	GTACTTCCTGTGTACTCTTTA	3' UTR	Inquiry
V0126XX440-2	CTTCGGTTTCTGAGCATAATG	3' UTR	Inquiry
V0126XX440-3	CCATGAGGCAAGAAACTATAT	CDS	Inquiry
V0126XX440-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human MAPK14 shRNA Lentiviral Particle (Silencing) facilitates the stable knockdown of p38 alpha MAPK, a kinase involved in adipocyte thermogenesis and stress responses. Utilizing an advanced RNAi platform with both U6 and miR30-based shRNA systems, researchers can evaluate the role of p38 in chronic insulin resistance. All particles are screened through exhaustive QC screening—including functional titer and sterility checks—to ensure consistent performance and experimental reproducibility.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: MAPK14

Full Name: Mitogen-activated protein kinase 14

Gene Symbol: RK; p38; CSBP; EXIP; Mxi2; CSBP1; CSBP2; CSPB1; PRKM14; PRKM15; SAPK2A; p38ALPHA

Gene ID: 1432

RefSeq ID-1: NP_001306.1

RefSeq ID-2: NM_001315.3

Summary: MAPK14 encodes a stress-responsive serine/threonine kinase belonging to the mitogen-activated protein kinase family. Acting as an integration hub for multiple signaling pathways, MAPK14 regulates key cellular processes including proliferation, differentiation, transcriptional control, and development. Activation of this kinase occurs in response to environmental stress and inflammatory cues through MKK-mediated phosphorylation or TAB1-induced autophosphorylation. MAPK14 phosphorylates a broad spectrum of substrates, such as ATF2, MEF2C, MAX, CDC25B, and p53, underscoring its involvement in transcriptional adaptation, cell cycle regulation, and genotoxic stress responses. Several alternatively spliced transcript variants encode distinct MAPK14 isoforms.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out