LipoKnoxa™ Human CERS6 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX627-1	ACCACACGACTGGGTATATTT	CDS	Inquiry
V0126XX627-2	CGGACGAACTAGGTGTTTAAT	3' UTR	Inquiry
V0126XX627-3	CGGCTCATCTTCGAGAGATTT	CDS	Inquiry
V0126XX627-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CERS6 shRNA Lentiviral Particle (Silencing) targets ceramide synthase 6, which generates lipids that promote obesity and peripheral insulin resistance. Silencing CERS6 via our advanced RNAi platform (U6 or miR30 based) allows for the investigation of bioactive lipids in metabolic disease. Each viral preparation is subjected to total QC verification—covering functional activity and microbial safety—to ensure that gene knockdown remains stable and effective in lipid signaling research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CERS6

Full Name: Ceramide synthase 6

Gene Symbol: CERS5; LASS6

Gene ID: 253782

RefSeq ID-1: NP_001243055.1

RefSeq ID-2: NM_001256126.2

Summary: CERS6 encodes a ceramide synthase responsible for sphingolipid biosynthesis. Ceramides are bioactive lipids implicated in insulin resistance and lipotoxicity. Increased ceramide production via CERS6 has been linked to obesity-induced metabolic impairment, particularly in liver and muscle tissues.

LipoKnoxa™ Human CERS6 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products