LipoKnoxa™ Human LEPR shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX425

Species: Human

Target Gene: LEPR

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human LEPR shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX425-1	CCTGGGCACAAGGACTTAATT	CDS	Inquiry
V0126XX425-2	GCCTATGAGCAAAGTAAATAT	CDS	Inquiry
V0126XX425-3	CCAGTGTGAAAGCAGAAATTA	CDS	Inquiry
V0126XX425-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human LEPR shRNA Lentiviral Particle (Silencing) is engineered for the robust inhibition of the LEPR, providing a powerful model for studying leptin resistance in vitro. Our platform utilizes dual-strategy shRNA systems—U6 for maximum depth and miR30-based for a more natural processing pathway—to meet diverse experimental demands. Supported by total quality control screening, these particles guarantee high purity and stable integration, allowing for consistent results in long-term metabolic homeostasis studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: LEPR

Full Name: Leptin receptor

Gene Symbol: OBR; OB-R; CD295; LEP-R; LEPRD

Gene ID: 3953

RefSeq ID-1: NP_001003679.1

RefSeq ID-2: NM_001003679.3

Summary: The protein encoded by the LEPR gene is a key member of the cytokine receptor 130 family, serving as the primary docking site for leptin (a body fat-regulating hormone). This receptor serves as a central hub linking fat storage and the central nervous system to regulate body fat metabolism by activating signaling pathways such as cytoplasmic STAT proteins. Functional mutations in LEPR are not only associated with human obesity but can also cause pituitary dysfunction. Notably, the LEPR gene shares its promoter and first two exons with its regulatory partner LEPROT, reflecting a complex and precise gene regulatory network.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out