Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human LEPR shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX425
Species: Human
Target Gene: LEPR
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human LEPR shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX425-1 CCTGGGCACAAGGACTTAATT CDS Inquiry
V0126XX425-2 GCCTATGAGCAAAGTAAATAT CDS Inquiry
V0126XX425-3 CCAGTGTGAAAGCAGAAATTA CDS Inquiry
V0126XX425-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human LEPR shRNA Lentiviral Particle (Silencing) is engineered for the robust inhibition of the LEPR, providing a powerful model for studying leptin resistance in vitro. Our platform utilizes dual-strategy shRNA systems—U6 for maximum depth and miR30-based for a more natural processing pathway—to meet diverse experimental demands. Supported by total quality control screening, these particles guarantee high purity and stable integration, allowing for consistent results in long-term metabolic homeostasis studies.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: LEPR
Full Name: Leptin receptor
Gene Symbol: OBR; OB-R; CD295; LEP-R; LEPRD
Gene ID: 3953
RefSeq ID-1: NP_001003679.1
RefSeq ID-2: NM_001003679.3
Summary: The protein encoded by the LEPR gene is a key member of the cytokine receptor 130 family, serving as the primary docking site for leptin (a body fat-regulating hormone). This receptor serves as a central hub linking fat storage and the central nervous system to regulate body fat metabolism by activating signaling pathways such as cytoplasmic STAT proteins. Functional mutations in LEPR are not only associated with human obesity but can also cause pituitary dysfunction. Notably, the LEPR gene shares its promoter and first two exons with its regulatory partner LEPROT, reflecting a complex and precise gene regulatory network.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.