LipoKnoxa™ Human SIRT1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX532-1	CAGGTCAAGGGATGGTATTTA	CDS	Inquiry
V0126XX532-2	GAGACTGTGATGTCATAATTA	CDS	Inquiry
V0126XX532-3	CATGAAGTGCCTCAGATATTA	CDS	Inquiry
V0126XX532-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human SIRT1 shRNA Lentiviral Particle (Silencing) targets sirtuin 1, a key regulator of metabolic health and aging. Developed through an advanced RNAi platform with a choice of U6 or miR30-based systems, this tool enables stable gene silencing for long-term study. Every batch is verified through a comprehensive QC suite—including functional titer, sequence accuracy, and mycoplasma detection.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: SIRT1

Full Name: Sirtuin 1

Gene Symbol: SIR2; SIR2L1; SIR2alpha

Gene ID: 23411

RefSeq ID-1: NP_001135970.1

RefSeq ID-2: NM_001142498.1

Summary: SIRT1 encodes a class I sirtuin protein characterized by a conserved catalytic core involved in intracellular regulatory processes. The protein functions as a metabolic sensor linking cellular energy status to transcriptional control, influencing pathways related to lipid utilization, glucose homeostasis, and insulin sensitivity. Multiple splice variants expand its functional versatility in metabolic tissues.

LipoKnoxa™ Human SIRT1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products