Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human NR3C1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX491
Species: Human
Target Gene: NR3C1
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human NR3C1 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX491-1 TTGGGTGGAGTTTCGTAATTT 3' UTR Inquiry
V0126XX491-2 TTTGCTCCTGATCTGATTATT CDS Inquiry
V0126XX491-3 CACAGGCTTCAGGTATCTTAT CDS Inquiry
V0126XX491-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human NR3C1 shRNA Lentiviral Particle (Silencing) is designed for the high-efficiency knockdown of the glucocorticoid receptor, a master regulator of fat distribution and stress-induced metabolism. Our system utilizes advanced RNAi frameworks, including high-potency U6-driven shRNA for maximal depth and physiologically refined miR30-based shRNA for reduced off-target effects. To ensure experimental success, every batch is subjected to comprehensive quality control (QC) covering functional titer, sterility, and mycoplasma testing, providing a reliable tool for long-term metabolic studies.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: NR3C1
Full Name: Nuclear receptor subfamily 3 group C member 1
Gene Symbol: GR; GCR; GRL; GCCR; GCRST
Gene ID: 2908
RefSeq ID-1: NP_000167.1
RefSeq ID-2: NM_000176.3
Summary: NR3C1 encodes the glucocorticoid receptor, which acts both as a transcription factor binding glucocorticoid response elements and as a regulator of other transcription factors. The receptor is mainly cytoplasmic but translocates to the nucleus upon ligand binding, influencing inflammation, cell proliferation, and differentiation. Alternative splicing produces multiple isoforms with distinct nuclear-cytoplasmic dynamics. Dysregulation of NR3C1 may affect energy metabolism and contribute to obesity.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.