Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human ATG7 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX607
Species: Human
Target Gene: ATG7
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human ATG7 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX607-1 CACCAGTTCAGAGCTAAATAA 3' UTR Inquiry
V0126XX607-2 CAAGGACATTAAGGGTTATTA CDS Inquiry
V0126XX607-3 TCCAAAGTTCTTGATCAATAT CDS Inquiry
V0126XX607-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human ATG7 shRNA Lentiviral Particle (Silencing) targets a core autophagy protein essential for maintaining cellular health and adipocyte differentiation. Silencing ATG7 via specialized U6 or miR30-based shRNA helps researchers evaluate how impaired autophagy leads to lipid accumulation and insulin resistance. Each preparation is backed by exhaustive QC documentation, confirming high functional titers and the absence of pathogens (sterility and mycoplasma), providing a high-performing technical platform for autophagy research.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ATG7
Full Name: Autophagy related 7
Gene Symbol: GSA7; APG7L; SCAR31; APG7-LIKE
Gene ID: 10533
RefSeq ID-1: NP_001129503.2
RefSeq ID-2: NM_001136031.3
Summary: ATG7 is an essential enzyme for the process of autophagy, the cell's internal recycling system. It is required for the formation of autophagosomes, which digest damaged components to provide energy during metabolic stress. ATG7 is particularly vital during the differentiation of fat cells, where it helps remodel the cellular architecture to accommodate large lipid droplets.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.