LipoKnoxa™ Human HNF4A shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX489-1	ATGACTTGAGGCCTTACTTAA	3' UTR	Inquiry
V0126XX489-2	TCAGGGTCTGAGCCCTATAAG	CDS	Inquiry
V0126XX489-3	GCCTACACCACCCTGGAATTT	CDS	Inquiry
V0126XX489-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human HNF4A shRNA Lentiviral Particle (Silencing) targets HNF4A, a master regulator of hepatic and pancreatic metabolism. By offering both U6 for maximum knockdown and miR30-based systems for natural processing, this lentiviral system provides a robust solution for researching Type 2 Diabetes pathways. Every batch undergoes total quality control screening for functional titer, sequence integrity, and sterility, ensuring reliable experimental outcomes.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: HNF4A

Full Name: Hepatocyte nuclear factor 4 alpha

Gene Symbol: TCF; HNF4; MODY; FRTS4; MODY1; NR2A1; TCF14; HNF4a7; HNF4a8; HNF4a9; NR2A21; TCF-14; HNF4alpha

Gene ID: 3172

RefSeq ID-1: NP_000448.3

RefSeq ID-2: NM_000457.4

Summary: HNF4A encodes a nuclear transcription factor that binds DNA as a homodimer and regulates hepatic, intestinal, and pancreatic gene expression. It acts upstream of HNF1A and other genes involved in glucose and lipid metabolism. Mutations in HNF4A cause monogenic, autosomal dominant non-insulin-dependent diabetes and may contribute to metabolic disturbances that increase susceptibility to obesity. Alternative splicing generates multiple isoforms with potentially distinct regulatory roles.

LipoKnoxa™ Human HNF4A shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products