Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human TP53INP2 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX608
Species: Human
Target Gene: TP53INP2
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human TP53INP2 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX608-1 CCAGGGAATAAGCCAAATTAA 3' UTR Inquiry
V0126XX608-2 CCTAGATCCATGTGGCTTTAT 3' UTR Inquiry
V0126XX608-3 ACTATCCCATGGTTGGCATTA 3' UTR Inquiry
V0126XX608-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human TP53INP2 shRNA Lentiviral Particle (Silencing) focuses on the inhibition of a scaffold protein involved in autophagy and thyroid hormone-mediated metabolic control. Our platform offers both U6 and miR30-based shRNA for stable modulation of nutrient-sensing pathways. To ensure the highest level of biosafety, all batches undergo total quality control screening, ensuring functional titers and sequence integrity for reliable research results in long-term cell line models.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: TP53INP2
Full Name: Tumor protein p53 inducible nuclear protein 2
Gene Symbol: DOR; PIGU; PINH; PIG-U; C20orf110; dJ1181N3.1
Gene ID: 58476
RefSeq ID-1: NP_001316358.1
RefSeq ID-2: NM_001329429.2
Summary: TP53INP2 acts as a dual-action coordinator within the cell. It promotes autophagy by facilitating the assembly of autophagosomes and simultaneously enters the nucleus to enhance the transcription of ribosomal DNA. This allows the cell to balance the breakdown of old proteins with the production of the new machinery needed for growth and adaptation.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.