Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human ACAT2 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX571
Species: Human
Target Gene: ACAT2
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human ACAT2 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX571-1 CTGGAAGATGTTGACATATTT CDS Inquiry
V0126XX571-2 AGAAGTCAGAAGCTGATAAAC CDS Inquiry
V0126XX571-3 TAAACCCAGAGAAGGTCAATA CDS Inquiry
V0126XX571-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human ACAT2 shRNA Lentiviral Particle (Silencing) is a precision-engineered tool designed for the robust and stable suppression of ACAT2, a key enzyme in hepatic cholesterol esterification. To ensure optimal silencing across various cellular environments, our platform utilizes high-potency U6-driven shRNA for maximum knockdown depth, as well as miR30-based architectures that mimic natural microRNA processing, resulting in reduced off-target effects. This product enables researchers to investigate the link between ACAT2 and hyperlipidemia or atherosclerosis. Every batch is subjected to total quality control, including functional titer, sterility, and mycoplasma testing, ensuring experimental repeatability and excellent biosafety for long-term cell line studies.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ACAT2
Full Name: Acetyl-CoA acetyltransferase 2
Gene ID: 39
RefSeq ID-1: NP_001290182.1
RefSeq ID-2: NM_001303253.1
Summary: ACAT2 encodes cytosolic acetoacetyl-CoA thiolase, an enzyme critical for lipid metabolism, including cholesterol and fatty acid synthesis. Variations in this gene may influence lipid storage and fat accumulation, contributing to obesity risk. In both humans and mice, ACAT2 partially overlaps with the 3′ region of TCP1 on opposite DNA strands. Alternative splicing produces multiple isoforms.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.