LipoKnoxa™ Human TSKU shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX51

Species: Human

Target Gene: TSKU

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human TSKU shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0525XX51-1	CCCACCATCTTGTGACAAATG	CDS	Inquiry
V0525XX51-2	GGAACCCTCTAGCTGTCATTG	CDS	Inquiry
V0525XX51-3	CCCGAGTAACTTATGTTCAAT	3' UTR	Inquiry
V0525XX51-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human TSKU shRNA Ad5 Adenoviral Particle (Silencing) delivers targeted genetic suppression of Tsukushi, a liver-secreted hepatokine that acts as an extracellular inhibitor of brown fat thermogenesis and systemic energy expenditure through its interaction with the gp130 signaling network. Knockdown of TSKU unleashes the activation of brown adipose tissue, enhancing energy utilization and providing a valuable loss-of-function model for metabolic rescue. Utilizing high-titer Ad5-mediated delivery of either classic U6 or microRNA-mimetic miR30-based shRNA sequences, this product achieves high-efficiency transduction. Every single batch undergoes stringent internal quality control testing—incorporating precise functional titer, sterility, and mycoplasma assays—to provide unparalleled safety and experimental reproducibility.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: TSKU

Full Name: Tsukushi, small leucine rich proteoglycan

Gene Symbol: TSK; E2IG4; LRRC54

Gene ID: 25987

RefSeq ID-1: NP_001245139.1

RefSeq ID-2: NM_001258210.2

Summary: TSKU encodes Tsukushi, a secreted extracellular protein predicted to interact with transforming growth factor-beta family members. Current evidence suggests roles in cholesterol transport, cholesterol balance, nervous system development, and regulation of Wnt signaling. The protein is localized to the extracellular space, where it may function as a modulator of signaling pathways involved in tissue development and metabolic regulation.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out