Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human TNMD shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX206
Species: Human
Target Gene: TNMD
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human TNMD shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX206-1 GAGAGAGGTTATTGTTGTATT CDS Inquiry
V0126XX206-2 CGCGTCTGTGAACCTTTACTA CDS Inquiry
V0126XX206-3 GAGGAAATAGATGAGAATGAA CDS Inquiry
V0126XX206-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human SREBF2 shRNA Ad5 Particle (Silencing) targets SREBP-2, the primary transcriptional activator of genes involved in cholesterol biosynthesis and uptake. Utilizing a miR30 or U6-based system, this product facilitates the study of cellular cholesterol homeostasis and its dysregulation in metabolic syndrome. All batches are screened through comprehensive QC protocols to ensure the repeatability of results and sequence integrity in molecular biology research.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: TNMD
Full Name: Tenomodulin
Gene Symbol: TEM; CHM1L; BRICD4
Gene ID: 64102
RefSeq ID-1: NP_071427.2
RefSeq ID-2: NM_022144.3
Summary: TNMD encodes a protein related to chondromodulin-I, a cartilage-associated glycoprotein that stimulates chondrocyte growth and inhibits endothelial tube formation. TNMD functions as an angiogenesis inhibitor and has been linked to the regulation of tissue vascularization. Genetic variants in TNMD are associated with central obesity, increased risk of type 2 diabetes, and altered circulating immune mediator levels in a body size–dependent manner. The gene has also been proposed as a candidate for age-related macular degeneration.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.