Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human ELOVL6 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX204
Species:
Human
Target Gene:
ELOVL6
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX204-1 | GCTCTGTATGCTGCCTTTATA | CDS | Inquiry |
| V0126XX204-2 | CCCTTGCAGTCTTCAGTATAT | CDS | Inquiry |
| V0126XX204-3 | GTCAGCAAATTCTGGGCTTAT | CDS | Inquiry |
| V0126XX204-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human EIF2AK3 shRNA Ad5 Particle (Silencing) targets the PERK kinase, a key sensor of endoplasmic reticulum (ER) stress that regulates protein translation. Knocking down EIF2AK3 through U6 or miR30-based shRNA is critical for studying the link between ER stress and pancreatic beta-cell failure in the context of obesity. Our customizable system allows for the flexible selection of reporter genes and ensures high viral potency through exhaustive QC screening, including titer validation and sequence accuracy checks.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
ELOVL6
Full Name:
ELOVL fatty acid elongase 6
Gene Symbol:
FAE; LCE; FACE; hELO2
Gene ID:
79071
RefSeq ID-1:
NP_001124193.1
RefSeq ID-2:
NM_001130721.2
Summary:
ELOVL6 encodes a fatty acid elongase that catalyzes the first and rate-limiting step in the elongation of long-chain fatty acids, using malonyl-CoA as a two-carbon donor. By regulating fatty acid chain length and composition in liver and adipose tissue, ELOVL6 influences lipid storage, insulin sensitivity, and metabolic flexibility, making it a key contributor to obesity-related lipid dysregulation.
Related Products
-
LipoKnoxa™ Human TFAP2B shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human EIF2S3 shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human PCSK1 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human SPX shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human PNLIP Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human BBS5 shRNA Ad5 Particle (Silencing)