LipoKnoxa™ Human SORL1 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX19

Species: Human

Target Gene: SORL1

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human SORL1 shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0525XX19-1	TGTATCCCACTGTCCTATAAA	CDS	Inquiry
V0525XX19-2	TGGATGATTGCGGCGATTATT	CDS	Inquiry
V0525XX19-3	AGTAACAACCGCACCAATTTA	CDS	Inquiry
V0525XX19-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human SORL1 shRNA Ad5 Adenoviral Particle (Silencing) is specialized for the downregulation of SORL1, an intracellular sorting receptor that plays a critical role in trafficking the leptin receptor and regulating sorting events in central energy balance networks. Impaired SORL1 expression has been strongly correlated with abnormal lipid accumulation and altered feeding behaviors. This tool leverages high-titer Ad5 to express U6 or miR30-based shRNA structures, giving researchers the flexibility to control cellular toxicity and expression profiles. Complete with options for customizable reporter genes, the product undergoes rigorous quality control pipelines—covering functional titer, sterility, and mycoplasma testing—to provide a reliable and safe genetic tool.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: SORL1

Full Name: Sortilin related receptor 1

Gene Symbol: LR11; LRP9; SORLA; gp250; SorLA-1; C11orf32

Gene ID: 6653

RefSeq ID-1: NP_003096.2

RefSeq ID-2: NM_003105.6

Summary: SORL1 encodes a mosaic receptor containing a VPS10 domain together with low-density lipoprotein receptor motifs, fibronectin type III repeats, and an EGF repeat. The precursor protein is proteolytically processed to a mature receptor that participates in endocytic trafficking and intracellular sorting. Genetic variation in SORL1 has been associated with susceptibility to Alzheimer's disease.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out