Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human KCNJ5 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX159
Species:
Human
Target Gene:
KCNJ5
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX159-1 | GCTCGTCTTCACCATGGTTTA | CDS | Inquiry |
| V0126XX159-2 | AGATCCATCCATATCACATAG | 3' UTR | Inquiry |
| V0126XX159-3 | CCATCACCTTGTCCCTCATTC | 3' UTR | Inquiry |
| V0126XX159-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human KCNJ5 shRNA Ad5 Particle (Silencing) targets the G-protein-activated inward rectifier potassium channel 4. While primarily known in adrenal research, it is increasingly studied for its role in systemic endocrine regulation that can influence metabolic outcomes. Our customizable system allows for the flexible selection of reporter genes and ensures high viral potency through exhaustive QC screening, including titer validation and sequence accuracy checks.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
KCNJ5
Full Name:
Potassium inwardly rectifying channel subfamily J member 5
Gene Symbol:
CIR; GIRK4; KATP1; LQT13; KIR3.4
Gene ID:
3762
RefSeq ID-1:
NP_000881.3
RefSeq ID-2:
NM_000890.3
Summary:
KCNJ5 forms potassium channels that are typically associated with aldosterone regulation. While often linked to adrenal health, its role in obesity stems from its influence on mineralocorticoid balance. Excessive aldosterone levels can promote systemic inflammation and oxidative stress, which are foundational to the development of metabolic syndrome and fat tissue dysfunction.
Related Products
-
AdipoUpX™ Human LPL Ad5 Particle (Overexpression)
-
AdipoUpX™ Human SLC2A4 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human BBS4 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human IL13 shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human GDF15 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human PNLIP shRNA Ad5 Particle (Silencing)