Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human IL13 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX195
Species:
Human
Target Gene:
IL13
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX195-1 | ACTTCGAAAGCATCATTATTT | 3' UTR | Inquiry |
| V0126XX195-2 | ATTGAAGTTGCAGATTCATTT | 3' UTR | Inquiry |
| V0126XX195-3 | CCTGCTCTTACATTTAAAGAA | CDS | Inquiry |
| V0126XX195-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human PLIN2 shRNA Ad5 Particle (Silencing) is engineered to silence perilipin 2, the primary protein coating lipid droplets in non-adipocyte tissues such as the liver and muscle. Suppressing PLIN2 via advanced U6 or miR30-based shRNA is vital for investigating the molecular drivers of ectopic lipid accumulation and lipotoxicity. Supporting flexible promoter and reporter configurations, the system undergoes exhaustive quality control—including functional titer, sequence verification, and mycoplasma detection—to guarantee the highest level of biosafety and data reproducibility.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
IL13
Full Name:
Interleukin 13
Gene Symbol:
P600; IL-13
Gene ID:
3596
RefSeq ID-1:
NP_002179.2
RefSeq ID-2:
NM_002188.2
Summary:
IL13 encodes an immunomodulatory cytokine predominantly produced by activated Th2 lymphocytes. It regulates multiple stages of B-cell maturation and differentiation by enhancing CD23 and MHC class II expression and promoting IgE class switching. IL13 also suppresses macrophage activation, thereby limiting the production of pro-inflammatory cytokines and chemokines. While IL13 is a key driver of allergen-induced asthma through mechanisms independent of IgE and eosinophils, it also contributes to immune regulation within adipose tissue. Altered IL13 signaling has been implicated in obesity-associated inflammation. IL13 is part of a cytokine gene cluster on chromosome 5q, located in proximity to IL4.
Related Products
-
LipoKnoxa™ Human ENPP2 shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human IKBKB shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human DGAT1 shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human SREBF1 shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human GFRAL shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human AKT1 shRNA Ad5 Particle (Silencing)