LipoKnoxa™ Human PRMT7 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX456-1	GGTCGTGGAACAAGCTATTTC	CDS	Inquiry
V0126XX456-2	ATGGCTTTAGTGATAAGATTA	CDS	Inquiry
V0126XX456-3	CTCGTGGTGGGACATTGAAAT	CDS	Inquiry
V0126XX456-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PRMT7 shRNA Lentiviral Particle (Silencing) targets PRMT7, an epigenetic regulator of adipogenesis and muscle development. Utilizing our advanced RNAi platform with a choice of U6 or miR30-based systems, researchers can evaluate the impact of arginine methylation on energy balance. This product is supported by comprehensive quality control covering functional titer, sterility, and mycoplasma testing, ensuring high biosafety for ex vivo applications.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PRMT7

Full Name: Protein arginine methyltransferase 7

Gene Symbol: SBIDDS

Gene ID: 54496

RefSeq ID-1: NP_001171753.1

RefSeq ID-2: NM_001184824.4

Summary: PRMT7 encodes a member of the protein arginine N-methyltransferase family. The enzyme transfers methyl groups to arginine residues on histones and other proteins, generating monomethylarginines. It plays roles in neuronal differentiation, male germline imprinting, small nuclear ribonucleoprotein biogenesis, and regulation of Wnt signaling. Mutations in PRMT7 are associated with syndromes involving intellectual disability, short stature, and other features. Additionally, the protein may enhance breast cancer cell invasion and metastasis.

LipoKnoxa™ Human PRMT7 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products