LipoKnoxa™ Human UCP2 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX435

Species: Human

Target Gene: UCP2

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human UCP2 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX435-1	CTACTGCCACTGTGAAGTTTC	CDS	Inquiry
V0126XX435-2	TTTCCTCTGGATACTGCTAAA	CDS	Inquiry
V0126XX435-3	CCTCTTCCTTCCGCTCCTTTA	3' UTR	Inquiry
V0126XX435-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human UCP2 shRNA Lentiviral Particle (Silencing) is engineered to silence UCP2, a modulator of mitochondrial reactive oxygen species and insulin secretion. By utilizing a choice between high-potency U6-driven shRNA and physiologically optimized miR30 architectures, researchers can study mitochondrial flexibility in pancreatic or immune cells, etc. Rigorous quality control, including high-precision functional titering and microbial testing, is performed on all particles to guarantee experimental safety.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: UCP2

Full Name: Uncoupling protein 2

Gene Symbol: UCPH; BMIQ4; SLC25A8

Gene ID: 7351

RefSeq ID-1: NP_001368872.1

RefSeq ID-2: NM_001381943.1

Summary: UCP2 codes for a member of the mitochondrial anion carrier protein family that mediates the "proton leak". This process effectively uncouples oxidative phosphorylation from ATP synthesis, releasing energy as heat. Expressed broadly across tissues, with peak levels in skeletal muscle, UCP2 is theorized to play a role in nonshivering thermogenesis and in protecting cells against oxidative stress. Its function has significant implications for obesity and diabetes susceptibility, positioning it as a key regulator of metabolic efficiency and cellular defense.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out