Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human TUB shRNA Lentiviral Particle (Silencing)
Cat. No.:
V0126XX472
Species:
Human
Target Gene:
TUB
Vector System:
Lentiviral
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX472-1 | GCAGGACATTTACCTCTTAAA | 3' UTR | Inquiry |
| V0126XX472-2 | GCATTTGATTTCTCCAGGTTT | 3' UTR | Inquiry |
| V0126XX472-3 | GAATAAGAACACGGAGAGTAT | CDS | Inquiry |
| V0126XX472-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human TUB shRNA Lentiviral Particle (Silencing) targets the TUBBY gene, which is essential for maintaining the health of hypothalamic neurons and metabolic balance. Utilizing an advanced RNAi framework with a choice of U6 or miR30-based systems, researchers can evaluate the mechanisms of adult-onset obesity. Every viral preparation is backed by exhaustive QC validation, including high-precision titering, sterility, and mycoplasma testing, ensuring optimal reliability.
Production Cell Line:
HEK293T
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test:
Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test:
Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC:
Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage:
Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability:
Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition:
Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes:
Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.
Target Profile
Gene Name:
TUB
Full Name:
TUB bipartite transcription factor
Gene Symbol:
rd5; RDOB
Gene ID:
7275
RefSeq ID-1:
NP_003311.2
RefSeq ID-2:
NM_003320.4
Summary:
TUB encodes a member of the Tubby family of bipartite transcription factors. The protein is suspected to play a significant role in both obesity and sensorineural hearing loss. Studies on the homologous protein in mice suggest that TUB functions as a membrane-bound transcription regulator. It is anchored to the plasma membrane but translocates to the nucleus in response to phosphoinositide hydrolysis. This translocation mechanism allows TUB to regulate gene expression in response to extracellular signals, directly linking membrane dynamics and signal transduction to nuclear processes that influence metabolic health. Two distinct isoforms have been identified.