LipoKnoxa™ Human PPARGC1A shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX482-1	GACTATTGCCAGTCAATTAAT	CDS	Inquiry
V0126XX482-2	TATGACAGCTACGAGGAATAT	CDS	Inquiry
V0126XX482-3	TTCCATGAAGACACGCTTAAA	3' UTR	Inquiry
V0126XX482-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PPARGC1A shRNA Lentiviral Particle (Silencing) targets PGC-1α, the master coactivator of mitochondrial biogenesis and energy metabolism. Engineered via our dual-strategy platform (U6 and miR30 systems), this tool enables the stable dissection of metabolic flexibility pathways. Every batch is verified through a comprehensive QC suite—including functional titer, sequence accuracy, and sterility testing—ensuring repeatable results in mitochondrial research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PPARGC1A

Full Name: PPARG coactivator 1 alpha

Gene Symbol: LEM6; PGC1; PGC1A; PGC-1v; PPARGC1; PGC-1alpha; PGC-1(alpha)

Gene ID: 10891

RefSeq ID-1: NP_001317680.1

RefSeq ID-2: NM_001330751.2

Summary: PPARGC1A encodes a transcriptional coactivator that regulates genes involved in energy metabolism and mitochondrial function. It interacts with PPARγ and other transcription factors such as CREB and nuclear respiratory factors (NRFs), linking environmental cues to metabolic gene regulation. PPARGC1A plays a pivotal role in determining muscle fiber type, controlling cholesterol balance, and regulating blood pressure. Dysregulation of this gene has been implicated in obesity and other metabolic disorders.

LipoKnoxa™ Human PPARGC1A shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products