Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human INSIG1 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX5
Species: Human
Target Gene: INSIG1
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human INSIG1 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0525XX5-1 TAACCACGCCAGTGCTAAATT CDS Inquiry
V0525XX5-2 CTTGAACTAAGACTCAATTAC 3' UTR Inquiry
V0525XX5-3 CACGCAGTTTCTCGTGTATAA CDS Inquiry
V0525XX5-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human INSIG1 shRNA Ad5 Adenoviral Particle (Silencing) is specifically developed to interrupt the expression of Insulin Induced Gene 1, an endoplasmic reticulum membrane protein that anchors SREBP/SCAP complexes to restrain de novo lipogenesis and cholesterol synthesis. Inhibiting INSIG1 triggers the uncontrolled activation of lipogenic pathways, making it a valuable model for accelerating adipocyte hypertrophy and fatty acid accumulation. Developed utilizing either standard U6 or specialized miR30-based shRNA expression architectures, this high-titer Ad5 vehicle ensures sweeping transduction in metabolic targets. Each product batch is subjected to stringently monitored quality assurance tests, validating functional titer, sterility, and mycoplasma parameters to safeguard the physiological integrity of your lipid metabolism data.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: INSIG1
Full Name: Insulin-induced gene 1 protein
Gene Symbol: CL6
Gene ID: 3638
RefSeq ID-1: NP_001333519.1
RefSeq ID-2: NM_001346590.1
Summary: INSIG1 encodes an endoplasmic reticulum membrane protein that serves as a critical regulator of lipid and cholesterol metabolism. The protein interacts with sterol-sensing proteins such as SCAP and HMG-CoA reductase, controlling their intracellular trafficking and stability in response to sterol levels. Through these mechanisms, INSIG1 helps coordinate cholesterol synthesis, fatty acid production, and glucose homeostasis. Multiple transcript variants generated through alternative splicing have been described.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.