Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human INPPL1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX513
Species: Human
Target Gene: INPPL1
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human INPPL1 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX513-1 CCACCCAAGAACAGCTTCAAT CDS Inquiry
V0126XX513-2 GACTACCTGAAAGGCAGCTAT CDS Inquiry
V0126XX513-3 GCAGCTCAATGCCTTTGACAT CDS Inquiry
V0126XX513-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human INPPL1 shRNA Lentiviral Particle (Silencing) targets SHIP2, a phosphatase that negatively regulates insulin signaling. Engineered via our dual-strategy platform (U6 and miR30 systems), this tool allows for the exploration of insulin sensitivity in stable cell models. We guarantee the quality of every batch through stringent QC verification, including sterility, mycoplasma testing, and functional titer.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: INPPL1
Full Name: Inositol polyphosphate phosphatase like 1
Gene Symbol: OPSMD; SHIP2
Gene ID: 3636
RefSeq ID-1: NP_001558.3
RefSeq ID-2: NM_001567.3
Summary: INPPL1 encodes an SH2-domain-containing 5-inositol phosphatase that functions as a potent negative regulator of insulin signaling. By dephosphorylating phosphoinositide messengers, it attenuates the cellular response to insulin, contributing to the development of insulin resistance. Beyond its metabolic role, INPPL1 is involved in actin remodeling and serves as a significant biomarker for metastatic progression in various cancers.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.