LipoKnoxa™ Human FTO shRNA Ad5 Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX2-1	CCCATTAGGTGCCCATATTTA	3' UTR	Inquiry
V0126XX2-2	GCCAGTGAAAGGGTCTAATAT	CDS	Inquiry
V0126XX2-3	TCGCATGGCAGCAAGCTAAAT	3' UTR	Inquiry
V0126XX2-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human FTO shRNA Ad5 Particle (Silencing) targets the FTO gene, providing researchers with a reliable method to investigate its role in nucleic acid demethylation and adipogenesis. This customizable platform supports the flexible inclusion of reporter genes (e.g., GFP/RFP) and various promoter systems, facilitating real-time monitoring of gene knockdown. To guarantee optimal reliability in large-scale obesity genomic studies, all particles are screened through comprehensive QC protocols covering sequence integrity and microbial contaminants.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: FTO

Full Name: Alpha-ketoglutarate-dependent dioxygenase

Gene Symbol: GDFD; IFEX9; ALKBH9; BMIQ14

Gene ID: 79068

RefSeq ID-1: NP_001073901.1

RefSeq ID-2: NM_001080432.3

Summary: The protein encoded by the FTO gene is a nuclear protein belonging to the AlkB-related non-heme iron and 2-oxoglutarate-dependent oxygenase superfamily. Other non-heme iron enzymes in this family are known to reverse DNA and RNA alkylation damage via oxidative demethylation. Studies in both mouse and human models indicate that this gene plays roles in the nervous and cardiovascular systems, and is significantly associated with body mass index (BMI), obesity risk, and type 2 diabetes mellitus.

LipoKnoxa™ Human FTO shRNA Ad5 Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products