Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human NR3C1 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX71
Species: Human
Target Gene: NR3C1
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human NR3C1 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX71-1 TTGGGTGGAGTTTCGTAATTT 3' UTR Inquiry
V0126XX71-2 TTTGCTCCTGATCTGATTATT CDS Inquiry
V0126XX71-3 CACAGGCTTCAGGTATCTTAT CDS Inquiry
V0126XX71-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human NR3C1 shRNA Ad5 Particle (Silencing) is a precision knockdown tool engineered to silence the GR, a central mediator of cortisol action in metabolic tissues. By utilizing our advanced RNAi platform with U6 or miR30-based shRNA systems, researchers can investigate how dysregulated GR signaling promotes visceral adiposity and insulin resistance. To ensure superior experimental accuracy, every batch undergoes a comprehensive QC suite, including functional titer measurement, sequence integrity verification, and rigorous testing for sterility and mycoplasma, guaranteeing the highest standards of safety and reproducibility.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: NR3C1
Full Name: Nuclear receptor subfamily 3 group C member 1
Gene Symbol: GR; GCR; GRL; GCCR; GCRST
Gene ID: 2908
RefSeq ID-1: NP_000167.1
RefSeq ID-2: NM_000176.3
Summary: NR3C1 encodes the glucocorticoid receptor, which acts as both a transcription factor and a regulator of other transcription factors. Normally located in the cytoplasm, the receptor translocates to the nucleus upon ligand binding to regulate genes involved in inflammation, cell proliferation, and differentiation. Mutations in NR3C1 are linked to generalized glucocorticoid resistance. Multiple transcript variants and alternative translation initiation sites generate isoforms with distinct cellular localization and transcriptional activities, which may influence energy balance and obesity susceptibility.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.