LipoKnoxa™ Human FABP5 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX622-1	CTTTGGACAGGAGTTAATTAA	3' UTR	Inquiry
V0126XX622-2	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human FABP5 shRNA Lentiviral Particle (Silencing) targets FABP5, involved in lipid-mediated signaling and glucose homeostasis. Our platform provides flexibility through the development of both U6 and miR30-based shRNA systems to study intracellular fat trafficking in adipose and skin tissues. To ensure experimental success, all particles undergo comprehensive quality control, covering functional titer, sequence integrity, and the absence of pathogens (sterility and mycoplasma).

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: FABP5

Full Name: Fatty acid binding protein 5

Gene Symbol: EFABP; KFABP; E-FABP; PAFABP; PA-FABP

Gene ID: 2171

RefSeq ID-1: NP_001435.1

RefSeq ID-2: NM_001444.3

Summary: FABP5 encodes a fatty acid–binding protein originally identified in epidermal cells and upregulated in psoriasis. Like other FABPs, it binds long-chain fatty acids and hydrophobic ligands, facilitating lipid uptake, intracellular transport, and metabolism. FABP5 is increasingly recognized as a regulator of lipid signaling pathways in adipocytes and macrophages, linking it to obesity, insulin resistance, and type 2 diabetes. Numerous pseudogenes related to FABP5 are present in the human genome.

LipoKnoxa™ Human FABP5 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products