Products
Online Inquiry
LipoKnoxa™ Human CTHRC1 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0525XX160
Species:
Human
Target Gene:
CTHRC1
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0525XX160-1 | TCTTCCCATTGAAGCTATAAT | CDS | Inquiry |
| V0525XX160-2 | CATTCTCTCAACCTATAATTT | 3' UTR | Inquiry |
| V0525XX160-3 | CTTGGAATGGTTCACTTAAAT | 3' UTR | Inquiry |
| V0525XX160-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human CTHRC1 shRNA Ad5 Adenoviral Particle (Silencing) achieves robust targeted suppression of CTHRC1, a secreted glycoprotein that modulates extracellular matrix (ECM) remodeling, tissue remodeling, and the migration of vascular cells into expanding fat pads. Silencing CTHRC1 alters structural stiffness dynamics and limits white adipose tissue expansion profiles, providing an excellent model to study the molecular dissociation between peripheral fat accumulation and localized mechanical signals during severe weight gain. Developed utilizing either standard U6 or specialized miR30-based shRNA expression architectures, this high-titer Ad5 vehicle ensures sweeping transduction in metabolic targets. Thorough validation across premium quality control tiers—including functional titration, sterility confirmation, and mycoplasma assays—ensures maximum experimental safety and data consistency.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
CTHRC1
Full Name:
Collagen triple helix repeat containing 1
Gene ID:
115908
RefSeq ID-1:
NP_001243028.1
RefSeq ID-2:
NM_001256099.2
Summary:
CTHRC1 encodes a secreted protein involved in tissue remodeling and vascular repair following injury. It is associated with extracellular matrix regulation and has been linked to pathological processes such as Barrett’s esophagus and esophageal adenocarcinoma.