LipoKnoxa™ Human CELA1 shRNA Ad5 Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0525XX110-1	GCTTACATCTCCTGGATAAAT	CDS	Inquiry
V0525XX110-2	CTTGGTGAATGGCAAGTATTC	CDS	Inquiry
V0525XX110-3	TCCATACTGGAACAGCGATAA	CDS	Inquiry
V0525XX110-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CELA1 shRNA Ad5 Adenoviral Particle (Silencing) is fine-tuned to suppress CELA1, an exocrine pancreatic serine protease that alters extracellular matrix remodeling and tissue elasticity cascades upon circulating into peripheral vascular beds. Suppressing CELA1 expression provides structural clues regarding adipose tissue expansion limitations and vascular compliance shifts during severe weight gain challenges. Our Ad5-driven vector system can be customized using high-potency U6 or advanced miR30-based shRNA architectures to optimize knockdown parameters in primary cellular models. Backed by rigorous comprehensive quality control screening—including rigorous functional titer, sterility, and mycoplasma testing—this product ensures outstanding safety and experimental reproducibility.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: CELA1

Full Name: Chymotrypsin like elastase 1

Gene Symbol: ELA1

Gene ID: 1990

RefSeq ID-1: NP_001962.3

RefSeq ID-2: NM_001971.5

Summary: CELA1 belongs to the elastase family of serine proteases. Unlike other elastases, its expression is primarily detected in skin keratinocytes rather than pancreatic tissue. While its physiological role is not fully defined, its proteolytic activity suggests potential involvement in extracellular matrix remodeling and tissue-level metabolic adaptation.

LipoKnoxa™ Human CELA1 shRNA Ad5 Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products