LipoKnoxa™ Human PPY shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX128

Species: Human

Target Gene: PPY

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human PPY shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX128-1	GCAGCTGATCTCCGTAGATAC	CDS	Inquiry
V0126XX128-2	ATGCTGACCAGGCCTAGGTAT	CDS	Inquiry
V0126XX128-3	CAATGCCACACCAGAGCAGAT	CDS	Inquiry
V0126XX128-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PPY shRNA Ad5 Particle (Silencing) targets PPY, a hormone involved in the regulation of gallbladder contraction and exocrine pancreatic secretion, with implications for satiety. Utilizing high-efficiency Ad5 delivery, this tool allows for the investigation of gastrointestinal influences on appetite. Every batch undergoes rigorous internal QC, including functional titer and sequence verification, ensuring the highest standards of reproducibility.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: PPY

Full Name: Pancreatic polypeptide

Gene Symbol: PH; PP; PNP

Gene ID: 5539

RefSeq ID-1: NP_002713.1

RefSeq ID-2: NM_002722.5

Summary: PPY produces a hormone in the pancreas that regulates gastrointestinal function and food intake. Reduced plasma levels of PPY are associated with increased appetite, while its administration in obese models has been shown to reduce weight gain by signaling satiety to the brain.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out