LipoKnoxa™ Human ADIRF shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX625-1	CCCTGTGTCCACTTCATGATT	3' UTR	Inquiry
V0126XX625-2	CACCCAGGAAACCATCGACAA	CDS	Inquiry
V0126XX625-3	CATCGACAAGACTGCTAACCA	CDS	Inquiry
V0126XX625-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ADIRF shRNA Lentiviral Particle (Silencing) targets ADIRF, which is critical for the initial stages of adipocyte formation. Utilizing an advanced dual-shRNA platform (U6 and miR30 systems), this product helps researchers study the transition of stem cells into adipocytes. Every batch is subjected to rigorous quality control, including high-sensitivity titer assays and sterility testing, to guarantee that gene silencing is both stable and safe for prolonged culture.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ADIRF

Full Name: Adipogenesis regulatory factor

Gene Symbol: AFRO; APM2; apM-2; C10orf116

Gene ID: 10974

RefSeq ID-1: NP_006820.1

RefSeq ID-2: NM_006829.3

Summary: ADIRF, also known as APM2, is exclusively expressed in adipose tissue. Although its precise biological function remains unclear, its adipose-specific expression pattern suggests a role in adipocyte differentiation or adipose tissue homeostasis, making it a candidate gene in obesity research.

LipoKnoxa™ Human ADIRF shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products