LipoKnoxa™ Human STAT3 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX529-1	CTCAGAGGATCCCGGAAATTT	CDS	Inquiry
V0126XX529-2	GGCGTCCAGTTCACTACTAAA	CDS	Inquiry
V0126XX529-3	CATCTGAAACTACTAACTTTG	3' UTR	Inquiry
V0126XX529-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human STAT3 shRNA Lentiviral Particle (Silencing) targets a downstream mediator of leptin signaling in the hypothalamus. Engineered with both U6 and miR30-based shRNA architectures, this tool enables the study of leptin resistance in stable cell lines. Every batch is verified through comprehensive QC validation, including high-precision functional titering and sterility testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: STAT3

Full Name: Signal transducer and activator of transcription 3

Gene Symbol: APRF; HIES; ADMIO; ADMIO1

Gene ID: 6774

RefSeq ID-1: NP_001356441.1

RefSeq ID-2: NM_001369512.1

Summary: STAT3 is a transcription factor that translates external cytokine signals (such as IL-6 or Leptin) into gene expression changes in the nucleus. It is a central node for cell growth, survival, and immune response. In the context of obesity, STAT3 is the primary messenger for leptin signaling in the hypothalamus; resistance in this pathway prevents the brain from receiving the "stop eating" signal, leading to hyperphagia and weight gain.

LipoKnoxa™ Human STAT3 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products