LipoKnoxa™ Human SREBF2 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX606-1	GAAAGGCGGACAACCCATAAT	CDS	Inquiry
V0126XX606-2	CCTCCACCTCTCTCTCGATTT	3' UTR	Inquiry
V0126XX606-3	CCTTCAGTGCAACGGTCATTC	CDS	Inquiry
V0126XX606-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human SREBF2 shRNA Lentiviral Particle (Silencing) provides a specialized solution for silencing SREBP-2, the master transcriptional activator for cholesterol biosynthesis. Engineered with both high-potency U6-driven shRNA and physiologically optimized miR30-based shRNA, this tool allows for the study of sterol homeostasis in metabolic syndrome. All products undergo rigorous quality control screening for functional titer and pathogens, ensuring consistent and reproducible gene-silencing effects.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: SREBF2

Full Name: Sterol regulatory element binding transcription factor 2

Gene Symbol: SREBP2; bHLHd2; SREBP-2

Gene ID: 6721

RefSeq ID-1: NP_004590.2

RefSeq ID-2: NM_004599.3

Summary: SREBF2 is the master "cholesterol thermostat" of the cell. This transcription factor senses when cellular cholesterol levels are low and subsequently activates the genes required for cholesterol synthesis and uptake. By maintaining this precise balance, SREBF2 ensures that cells have enough cholesterol for membranes while preventing toxic excess.

LipoKnoxa™ Human SREBF2 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products