LipoKnoxa™ Human SORBS1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX587-1	CCTCTGCAGAAGGGAGATATT	CDS	Inquiry
V0126XX587-2	TACTCTCCCAGATACTCATTT	CDS	Inquiry
V0126XX587-3	GATTCCAGTCCTCTACTAAAT	CDS	Inquiry
V0126XX587-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human SORBS1 shRNA Lentiviral Particle (Silencing) targets SORBS1, essential for insulin-stimulated glucose uptake. Silencing SORBS1 via our advanced RNAi platform (using either U6 or miR30-based systems) allows researchers to explore the mechanisms of skeletal muscle or adipose insulin resistance. Every preparation is verified via thorough QC validation—including sequence integrity and microbial purity checks—to ensure high functional titers and safety for complex metabolic studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: SORBS1

Full Name: Sorbin and SH3 domain containing 1

Gene Symbol: CAP; FLAF2; R85FL; SH3D5; SORB1; SH3P12

Gene ID: 10580

RefSeq ID-1: NP_001030126.2

RefSeq ID-2: NM_001034954.3

Summary: SORBS1 encodes an adaptor protein involved in insulin signaling and glucose uptake in adipocytes and muscle. Dysregulation or genetic variants contribute to insulin resistance and obesity. Alternative splicing produces multiple isoforms with potential tissue-specific functions.

LipoKnoxa™ Human SORBS1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products