LipoKnoxa™ Human NTRK2 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX439

Species: Human

Target Gene: NTRK2

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human NTRK2 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX439-1	GCTATTTGAATGGTCAGATAT	3' UTR	Inquiry
V0126XX439-2	CCTTAAGGATAACTAACATTT	CDS	Inquiry
V0126XX439-3	TCCTGGTGGGCAATCCATTTA	CDS	Inquiry
V0126XX439-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human NTRK2 shRNA Lentiviral Particle (Silencing) is engineered to silence the TrkB receptor, the primary mediator of BDNF signaling in satiety control. Our system provides two distinct expression strategies: high-potency U6-driven shRNA and physiologically optimized miR30-based shRNA for reduced toxicity in neuronal cell lines. Each batch is subjected to comprehensive quality control—including functional titer, sequence integrity, and sterility—providing a secure and high-performing gene-silencing solution.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: NTRK2

Full Name: Neurotrophic receptor tyrosine kinase 2

Gene Symbol: OBHD; TRKB; DEE58; trk-B; EIEE58; GP145-TrkB

Gene ID: 4915

RefSeq ID-1: NP_001007098.1

RefSeq ID-2: NM_001007097.3

Summary: NTRK2 codes for a membrane-bound kinase belonging to the neurotrophic tyrosine receptor kinase (NTRK) family, also known as TrkB. This receptor is activated upon binding to its neurotrophin ligands, leading to its autophosphorylation and the initiation of downstream cascades, notably the MAPK pathway. Signaling through NTRK2 is critical for neuronal cell differentiation and survival. Gene mutations or variants have been clinically associated with both obesity susceptibility and various mood disorders, suggesting a critical role in central nervous system energy balance and affective regulation.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out