Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human SLC27A2 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX70
Species: Human
Target Gene: SLC27A2
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human SLC27A2 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0525XX70-1 GCTGATTACCTACCTAGTTAT CDS Inquiry
V0525XX70-2 CCTATGACTGAGGACATCTAT CDS Inquiry
V0525XX70-3 CCATACTTCTTCCAGGACATA CDS Inquiry
V0525XX70-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human SLC27A2 shRNA Ad5 Adenoviral Particle (Silencing) targets SLC27A2 (FATP2), a liver- and kidney-specific fatty acid transport protein and long-chain acyl-CoA synthetase that mediates the cellular uptake of exogenous long-chain fatty acids. Silencing SLC27A2 effectively intercepts the influx of saturated fatty acids into hepatocytes, offering profound insights into the prevention of hepatic steatosis and lipotoxicity-induced cellular stress. Our Ad5-driven vector system can be customized using high-potency U6 or advanced miR30-based shRNA architectures to optimize knockdown parameters in primary human hepatic models. Subject to exhaustive comprehensive quality control protocols—covering precise viral titration, sterility screening, and mycoplasma validation—this targeted silencing agent secures precise and reliable metabolic data.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: SLC27A2
Full Name: Solute carrier family 27 member 2
Gene Symbol: VLCS; FATP2; VLACS; ACSVL1; FACVL1; hFACVL1; HsT17226
Gene ID: 11001
RefSeq ID-1: NP_001153101.1
RefSeq ID-2: NM_001159629.2
Summary: SLC27A2 encodes a fatty acid transport protein with long-chain acyl-CoA synthetase activity, enabling the activation of long-chain, branched-chain, and very-long-chain fatty acids. The protein is primarily expressed in the liver and kidney and is localized to both the endoplasmic reticulum and peroxisomes. Through its role in fatty acid activation, SLC27A2 supports lipid metabolism, energy utilization, and peroxisomal fatty acid processing. Reduced activity of this enzyme contributes to metabolic abnormalities observed in certain inherited disorders, including X-linked adrenoleukodystrophy.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.