Products
Online Inquiry
LipoKnoxa™ Human SCTR shRNA Ad5 Particle (Silencing)
Cat. No.:
V0525XX131
Species:
Human
Target Gene:
SCTR
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0525XX131-1 | GAAATGAAGTCAGCCATTATA | CDS | Inquiry |
| V0525XX131-2 | GGAAATGAAGTCAGCCATTAT | CDS | Inquiry |
| V0525XX131-3 | GATCCTCTCCATCCTGATTAA | CDS | Inquiry |
| V0525XX131-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human SCTR shRNA Ad5 Adenoviral Particle (Silencing) provides selective knockdown of the Secretin Receptor, a G protein-coupled receptor that acts as a vital player in the gut-brain-adipose axis, regulating lipolysis, fluid homeostasis, and central energy expenditure circuits. Suppressing SCTR expression provides direct insights into how blunted secretin-mediated gut signaling drives brown fat inactivation and limits acute prandial thermogenesis. Developed utilizing either standard U6 or specialized miR30-based shRNA expression architectures, this high-titer Ad5 vehicle ensures sweeping transduction. Backed by rigorous comprehensive quality control screening—including rigorous functional titer, sterility, and mycoplasma testing—this product ensures outstanding safety and experimental reproducibility.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
SCTR
Full Name:
Secretin receptor
Gene Symbol:
SR; SECR
Gene ID:
6344
RefSeq ID-1:
NP_002971.2
RefSeq ID-2:
NM_002980.3
Summary:
SCTR encodes the secretin receptor, a G protein-coupled receptor that mediates the physiological effects of secretin in pancreatic and gastrointestinal secretion. It regulates bicarbonate and fluid secretion in the pancreas and has been implicated in gastrointestinal function and disease processes.