LipoKnoxa™ Human PYY shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX445-1	CCGGACACGCTTCTTTCCAAA	CDS	Inquiry
V0126XX445-2	CCAACCACGCCCACGTCATTT	3' UTR	Inquiry
V0126XX445-3	CGCCTTGACCACAGTGCTTCT	CDS	Inquiry
V0126XX445-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PYY shRNA Lentiviral Particle (Silencing) targets peptide YY, a gastrointestinal hormone that signals satiety to the brain. Knocking down PYY via U6 or miR30-based shRNA systems enables the detailed investigation of the gut-brain axis in vitro. Each preparation is subjected to rigorous QC—including functional titer and sterility—to guarantee the highest level of biosafety and reliable experimental outcomes.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PYY

Full Name: Peptide YY

Gene Symbol: PYY1; PYY-I

Gene ID: 5697

RefSeq ID-1: NP_001380957.1

RefSeq ID-2: NM_001394028.1

Summary: PYY is the precursor gene for a peptide belonging to the neuropeptide Y (NPY) family. The encoded preproprotein is proteolytically processed in the gut's endocrine cells to generate two bioactive peptide forms (PYY (1-36) and PYY (3-36)) that primarily act on NPY receptors. These peptides are secreted post-prandially and function to regulate pancreatic secretion, gut motility, and, most importantly, energy homeostasis. PYY acts as a key satiety signal, suppressing appetite. Rare variants in PYY can influence susceptibility to obesity, while elevated circulating levels have been associated with anorexia nervosa.

LipoKnoxa™ Human PYY shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products