Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human PTPN1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX514
Species: Human
Target Gene: PTPN1
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human PTPN1 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX514-1 TTTGACCATAGTCGGATTAAA CDS Inquiry
V0126XX514-2 CTGTGATCGAAGGTGCCAAAT CDS Inquiry
V0126XX514-3 GAAGCCCAAAGGAGTTACATT CDS Inquiry
V0126XX514-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human PTPN1 shRNA Lentiviral Particle (Silencing) targets PTP1B, which dephosphorylates the insulin and leptin receptors. By utilizing either high-potency U6-driven shRNA or physiologically refined miR30-based shRNA, researchers can investigate metabolic sensitization. Every preparation is verified via thorough QC validation, including sequence integrity and microbial purity checks.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PTPN1
Full Name: Protein tyrosine phosphatase non-receptor type 1
Gene Symbol: PTP1B
Gene ID: 5770
RefSeq ID-1: NP_001265547.1
RefSeq ID-2: NM_001278618.1
Summary: PTPN1 is the archetypal protein tyrosine phosphatase that acts as a major metabolic "brake." It regulates signaling by removing phosphate groups from tyrosine residues on the insulin receptor and the JAK2/TYK2 kinases. Excessive PTPN1 activity is a hallmark of both insulin and leptin resistance, making it a high-priority therapeutic target for reversing the metabolic imbalances found in obese and diabetic populations.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.